Review



plko 1 scramble shrna lentiviral vector  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 96
      Buy from Supplier

    Structured Review

    Addgene inc plko 1 scramble shrna lentiviral vector
    Plko 1 Scramble Shrna Lentiviral Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1096 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/lentiviral+vector+plko+1+scramble/scramble+shRNA+(Plasmid+%231864)/pm37770150-42-0-4
    Average 96 stars, based on 1096 article reviews
    plko 1 scramble shrna lentiviral vector - by Bioz Stars, 2026-10
    96/100 stars

    Images

    Related Articles

    Plasmid Preparation:

    Article Title: Gamma-glutamyltransferase 1 promotes clear cell renal cell carcinoma initiation and progression
    Article Snippet: .. The lentiviral vector pLKO.1 Scramble (plasmid no. 17920) was obtained from Addgene. pLKO.1 lentiviral vectors expressing hairpins against shGGT1_1 (clone ID: TRCN0000036289, sequence TTTCGTGTGGTGCTGTTGTAG) and shGGT1_2 (TRCN0000036293, sequence TTGTAGATGGTGAGGAAGAGG) were obtained from The TRC (The RNAi Consortium) at the Broad Institute and GE Dharmacon. ..

    Article Title: Arginase 2 Suppresses Renal Carcinoma Progression via Biosynthetic Cofactor Pyridoxal Phosphate Depletion and Increased Polyamine Toxicity
    Article Snippet: .. The lentiviral vector pLKO.1 Scramble (plasmid no. 17920) was obtained from Addgene. pLKO.1 lentiviral vectors expressing hairpins against ARG2 SH-1 (TRCN0000051018), ARG2 SH-2 (TRCN0000051020), ASS1 SH-3 (TRCN0000045554), and ASS1 SH-4 (TRCN0000045553) were obtained from The RNAi Consortium (TRC) at the Broad Institute and GE Dharmacon. .. For genetic knockout using CRISPR/Cas9, the lentiviral vector lentiCRISPR v2 was obtained from Addgene (plasmid no. 52961).

    Article Title: Gamma-Glutamyltransferase 1 Promotes Clear Cell Renal Cell Carcinoma Initiation and Progression
    Article Snippet: .. The lentiviral vector pLKO.1 Scramble (plasmid no. 17920) was obtained from Addgene. pLKO.1 lentiviral vectors expressing hairpins against shGGT1_1 (clone ID: on June 4, 2019. .. © 2019 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from 6 TRCN0000036289, sequence TTTCGTGTGGTGCTGTTGTAG) and shGGT1_2 (TRCN0000036293, sequence TTGTAGATGGTGAGGAAGAGG) were obtained from The TRC (The RNAi Consortium) at the Broad Institute and GE Dharmacon.

    Expressing:

    Article Title: Gamma-glutamyltransferase 1 promotes clear cell renal cell carcinoma initiation and progression
    Article Snippet: .. The lentiviral vector pLKO.1 Scramble (plasmid no. 17920) was obtained from Addgene. pLKO.1 lentiviral vectors expressing hairpins against shGGT1_1 (clone ID: TRCN0000036289, sequence TTTCGTGTGGTGCTGTTGTAG) and shGGT1_2 (TRCN0000036293, sequence TTGTAGATGGTGAGGAAGAGG) were obtained from The TRC (The RNAi Consortium) at the Broad Institute and GE Dharmacon. ..

    Article Title: Arginase 2 Suppresses Renal Carcinoma Progression via Biosynthetic Cofactor Pyridoxal Phosphate Depletion and Increased Polyamine Toxicity
    Article Snippet: .. The lentiviral vector pLKO.1 Scramble (plasmid no. 17920) was obtained from Addgene. pLKO.1 lentiviral vectors expressing hairpins against ARG2 SH-1 (TRCN0000051018), ARG2 SH-2 (TRCN0000051020), ASS1 SH-3 (TRCN0000045554), and ASS1 SH-4 (TRCN0000045553) were obtained from The RNAi Consortium (TRC) at the Broad Institute and GE Dharmacon. .. For genetic knockout using CRISPR/Cas9, the lentiviral vector lentiCRISPR v2 was obtained from Addgene (plasmid no. 52961).

    Article Title: Gamma-Glutamyltransferase 1 Promotes Clear Cell Renal Cell Carcinoma Initiation and Progression
    Article Snippet: .. The lentiviral vector pLKO.1 Scramble (plasmid no. 17920) was obtained from Addgene. pLKO.1 lentiviral vectors expressing hairpins against shGGT1_1 (clone ID: on June 4, 2019. .. © 2019 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from 6 TRCN0000036289, sequence TTTCGTGTGGTGCTGTTGTAG) and shGGT1_2 (TRCN0000036293, sequence TTGTAGATGGTGAGGAAGAGG) were obtained from The TRC (The RNAi Consortium) at the Broad Institute and GE Dharmacon.

    Sequencing:

    Article Title: Gamma-glutamyltransferase 1 promotes clear cell renal cell carcinoma initiation and progression
    Article Snippet: .. The lentiviral vector pLKO.1 Scramble (plasmid no. 17920) was obtained from Addgene. pLKO.1 lentiviral vectors expressing hairpins against shGGT1_1 (clone ID: TRCN0000036289, sequence TTTCGTGTGGTGCTGTTGTAG) and shGGT1_2 (TRCN0000036293, sequence TTGTAGATGGTGAGGAAGAGG) were obtained from The TRC (The RNAi Consortium) at the Broad Institute and GE Dharmacon. ..



    Similar Products

    plko 1 scramble shrna lentiviral vector  (Addgene inc)
    96
    Addgene inc plko 1 scramble shrna lentiviral vector
    Plko 1 Scramble Shrna Lentiviral Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/lentiviral+vector+plko+1+scramble/scramble+shRNA+(Plasmid+%231864)/pm37770150-42-0-4
    Average 96 stars, based on 1 article reviews
    plko 1 scramble shrna lentiviral vector - by Bioz Stars, 2026-10
    96/100 stars
    		  Buy from Supplier
    plko 1 lentiviral vector  (Addgene inc)
    96
    Addgene inc plko 1 lentiviral vector
    Plko 1 Lentiviral Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/lentiviral+vector+plko+1+scramble/scramble+shRNA+(Plasmid+%231864)/pm36602641-41-14-18
    Average 96 stars, based on 1 article reviews
    plko 1 lentiviral vector - by Bioz Stars, 2026-10
    96/100 stars
    		  Buy from Supplier
    lentiviral plko.1-puro vectors encoding survivin-specific scrambled shrna  (Millipore)
    90
    Millipore lentiviral plko.1-puro vectors encoding survivin-specific scrambled shrna
    Lentiviral Plko.1 Puro Vectors Encoding Survivin Specific Scrambled Shrna, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/lentiviral+vector+plko+1+scramble/plko+1+vector/pmc06984589-30-15-27
    Average 90 stars, based on 1 article reviews
    lentiviral plko.1-puro vectors encoding survivin-specific scrambled shrna - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    plko 1 lentiviral vector system  (Addgene inc)
    95
    Addgene inc plko 1 lentiviral vector system
    Plko 1 Lentiviral Vector System, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/lentiviral+vector+plko+1+scramble/PLKO%2E1-Scrambled+(Plasmid+%23136035)/ppr0578453-126-29-33
    Average 95 stars, based on 1 article reviews
    plko 1 lentiviral vector system - by Bioz Stars, 2026-10
    95/100 stars
    		  Buy from Supplier
    plko.1 lentiviral vector expresses scramble shrna negative control  (Millipore)
    90
    Millipore plko.1 lentiviral vector expresses scramble shrna negative control
    Plko.1 Lentiviral Vector Expresses Scramble Shrna Negative Control, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/lentiviral+vector+plko+1+scramble/plko+1+vector/pm34965173-67-7-24
    Average 90 stars, based on 1 article reviews
    plko.1 lentiviral vector expresses scramble shrna negative control - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    lentiviral vector plko  (Addgene inc)
    95
    Addgene inc lentiviral vector plko
    Lentiviral Vector Plko, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/lentiviral+vector+plko+1+scramble/PLKO%2E1-Scrambled+(Plasmid+%23136035)/pm32556197-83-22-31
    Average 95 stars, based on 1 article reviews
    lentiviral vector plko - by Bioz Stars, 2026-10
    95/100 stars
    		  Buy from Supplier
    lentiviral vectors plko.1 encoding scrambled shctrl  (Addgene inc)
    90
    Addgene inc lentiviral vectors plko.1 encoding scrambled shctrl
    H 2 O 2 -induced apoptosis of ovarian cancer cells after downregulation <t>of</t> <t>PHLDA1.</t> ( A and B ) Flow cytometric analysis of 2008 cells ( A ) and SKOV3 cells ( B ) expressing control <t>(shctrl)</t> or PHLDA1-targeting shRNAs (shPHLDA1). Lower right and upper right quadrants showed early apoptotic and late apoptotic/necrotic cells, respectively. n=3, * P <0.05, ** P <0.001, compared with the shctrl group. ( C and D ) Western blot analysis of the apoptosis marker c-PARP1 in 2008 ( C ) and SKOV3 ( D ) cell lines expressing shctrl or shPHLDA1.
    Lentiviral Vectors Plko.1 Encoding Scrambled Shctrl, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/lentiviral+vector+plko+1+scramble/plko+1/pmc08364641-46-7-10
    Average 90 stars, based on 1 article reviews
    lentiviral vectors plko.1 encoding scrambled shctrl - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier

    Image Search Results


    H 2 O 2 -induced apoptosis of ovarian cancer cells after downregulation of PHLDA1. ( A and B ) Flow cytometric analysis of 2008 cells ( A ) and SKOV3 cells ( B ) expressing control (shctrl) or PHLDA1-targeting shRNAs (shPHLDA1). Lower right and upper right quadrants showed early apoptotic and late apoptotic/necrotic cells, respectively. n=3, * P <0.05, ** P <0.001, compared with the shctrl group. ( C and D ) Western blot analysis of the apoptosis marker c-PARP1 in 2008 ( C ) and SKOV3 ( D ) cell lines expressing shctrl or shPHLDA1.

    Journal: Journal of Cancer

    Article Title: PHLDA1 Modulates the Endoplasmic Reticulum Stress Response and is required for Resistance to Oxidative Stress-induced Cell Death in Human Ovarian Cancer Cells

    doi: 10.7150/jca.45262

    Figure Lengend Snippet: H 2 O 2 -induced apoptosis of ovarian cancer cells after downregulation of PHLDA1. ( A and B ) Flow cytometric analysis of 2008 cells ( A ) and SKOV3 cells ( B ) expressing control (shctrl) or PHLDA1-targeting shRNAs (shPHLDA1). Lower right and upper right quadrants showed early apoptotic and late apoptotic/necrotic cells, respectively. n=3, * P <0.05, ** P <0.001, compared with the shctrl group. ( C and D ) Western blot analysis of the apoptosis marker c-PARP1 in 2008 ( C ) and SKOV3 ( D ) cell lines expressing shctrl or shPHLDA1.

    Article Snippet: Cells were infected by lentiviral vectors pLKO.1 encoding scrambled shctrl (Addgene, Cambridge, MA, USA) or one of the three PHLDA1-targeting shRNAs (all from Sigma, St. Louis, MO, USA): shPHLDA1-1 (CCG GCC TAA TCC GTA GTA ATT CCT ACT CGA GTA GGA ATT ACT ACG GAT TAG GTT TTTG), shPHLDA1-2 (CCG GCA GAT CAA GTA GTT TGG ACA TCT CGA GAT GTC CAA ACT ACT TGA TCT GTT TTT TG), and shPHLDA1-3 (CCG GCG AGC ACA TTT CTA TTG TCT TCT CGA GAA GAC AAT AGA AAT GTG CTC GTT TTT TG).

    Techniques: Expressing, Control, Western Blot, Marker

    ER stress-induced apoptosis of ovarian cancer cells after downregulation of PHLDA1 . Apoptosis assay of 2008 ( A ) and SKOV3 ( B ) cells expressing shctrl or shPHLDA1 after treatment with thapsigargin (Tg). ** P <0.001 compared with the shctrl group. Mean ± SD, n = 3.

    Journal: Journal of Cancer

    Article Title: PHLDA1 Modulates the Endoplasmic Reticulum Stress Response and is required for Resistance to Oxidative Stress-induced Cell Death in Human Ovarian Cancer Cells

    doi: 10.7150/jca.45262

    Figure Lengend Snippet: ER stress-induced apoptosis of ovarian cancer cells after downregulation of PHLDA1 . Apoptosis assay of 2008 ( A ) and SKOV3 ( B ) cells expressing shctrl or shPHLDA1 after treatment with thapsigargin (Tg). ** P <0.001 compared with the shctrl group. Mean ± SD, n = 3.

    Article Snippet: Cells were infected by lentiviral vectors pLKO.1 encoding scrambled shctrl (Addgene, Cambridge, MA, USA) or one of the three PHLDA1-targeting shRNAs (all from Sigma, St. Louis, MO, USA): shPHLDA1-1 (CCG GCC TAA TCC GTA GTA ATT CCT ACT CGA GTA GGA ATT ACT ACG GAT TAG GTT TTTG), shPHLDA1-2 (CCG GCA GAT CAA GTA GTT TGG ACA TCT CGA GAT GTC CAA ACT ACT TGA TCT GTT TTT TG), and shPHLDA1-3 (CCG GCG AGC ACA TTT CTA TTG TCT TCT CGA GAA GAC AAT AGA AAT GTG CTC GTT TTT TG).

    Techniques: Apoptosis Assay, Expressing

    Expression of autophagy-related proteins, anti-apoptosis proteins, ER stress-associated proteins after PHLDA1-downregulation in ovarian cancer cells. ( A ) Western blot analysis of Autophagy-related proteins (Beclin-1, P62, and LC3) and anti-apoptosis protein (Bcl-2) in 2008 cells expressing shctrl or shPHLDA1 after treatment with 0.2 mM H 2 O 2 . ( B and C ) Western blot analysis of ER stress-associated proteins (IRE1α, PERK, BIP, ERO1-Lα, and PDI) in 2008 ( B ) and SKOV3 ( C ) cells after treatment with 0.2 mM H 2 O 2 .

    Journal: Journal of Cancer

    Article Title: PHLDA1 Modulates the Endoplasmic Reticulum Stress Response and is required for Resistance to Oxidative Stress-induced Cell Death in Human Ovarian Cancer Cells

    doi: 10.7150/jca.45262

    Figure Lengend Snippet: Expression of autophagy-related proteins, anti-apoptosis proteins, ER stress-associated proteins after PHLDA1-downregulation in ovarian cancer cells. ( A ) Western blot analysis of Autophagy-related proteins (Beclin-1, P62, and LC3) and anti-apoptosis protein (Bcl-2) in 2008 cells expressing shctrl or shPHLDA1 after treatment with 0.2 mM H 2 O 2 . ( B and C ) Western blot analysis of ER stress-associated proteins (IRE1α, PERK, BIP, ERO1-Lα, and PDI) in 2008 ( B ) and SKOV3 ( C ) cells after treatment with 0.2 mM H 2 O 2 .

    Article Snippet: Cells were infected by lentiviral vectors pLKO.1 encoding scrambled shctrl (Addgene, Cambridge, MA, USA) or one of the three PHLDA1-targeting shRNAs (all from Sigma, St. Louis, MO, USA): shPHLDA1-1 (CCG GCC TAA TCC GTA GTA ATT CCT ACT CGA GTA GGA ATT ACT ACG GAT TAG GTT TTTG), shPHLDA1-2 (CCG GCA GAT CAA GTA GTT TGG ACA TCT CGA GAT GTC CAA ACT ACT TGA TCT GTT TTT TG), and shPHLDA1-3 (CCG GCG AGC ACA TTT CTA TTG TCT TCT CGA GAA GAC AAT AGA AAT GTG CTC GTT TTT TG).

    Techniques: Expressing, Western Blot